Microsoft Word Paper 10- Nassaj et al 91A52-3

اندازه: px
شروع نمایش از صفحه:

Download "Microsoft Word Paper 10- Nassaj et al 91A52-3"

رونوشت

1 Cucumber green ) 1391/8/24 : 1391/6/28 : (mosaic mottle virus, CGMMV ().. 30 HC-Pro P1... RT-PCR.. SDS-PAGE 2/2 1/ : : : 143

2 (Ainworth, 1935) Komuro, 1965; ) Rahimian & Izadpanah, 1977; Francki et al.,.(1986; Lee et al., 1990 CGMMV.(Saito et al., 1988) Cucumber green mottle mosaic virus; Tobamovirus (CGMMV) Virgaviridae 15 Antignus et al., 2001; Shang ) CGMMV.(et al., (Tan et al., 2000) 6450.(Ugaki et al., 1991) : ( ) ( 30 MP) ( 17 CP) 25 Ugaki et al., 1991; ) 5.(Tan et al., 2000; King et al., (King et al., 2012) trna.(shang et al., 2011).

3 10 NIa Riechmann et al., 1992; HC-Pro P1 ).(Revers et al., 1999; King et al., 2012 HC-Pro P1 Oh & ).(Carrington, 1989; Verchot et al., 1991 Carrington & NIa ).(Dougherty, 1988; Riechmann et al., 1992 cdna Lin et al. (2002) (green fluorescent GFP HC-Pro (ZTN3) TW-TN3 (.(Lin et al., 2002) protein). GFP CGMMV. Gleba et al., 2004; Mett et al., ).(2008; Egelkrout et al., 2012 Gopinath et al., 2000; Alamillo et al., 2006; ).(Gleba et al., 2007 (scfv) Chen ) Zucchini.(et al., 2005; Gleba et al., 2008 ) (yellow mosaic virus; Potyvirus.(Desbiez et al., 1997) 9/6 RNA 145

4 1392. (10X) 2/5 0/ pcgmp dntp mz1155) Taq DNA polymerase PCR ( (Invitrogen, USA) ºC RT-PCR (Invitrogen, USA) TRIzol (cdna). 0/5 10 mz1155 8/5 ( ). 75 RT ºC 2/5 10 0/1 dntps DTT (10x) 2/5 0/5 (MMuLV, Invitrogen, USA) ºC pcgmp-bns). 42 colony PCR (PCR) (RT) CGMMV MP KpnI SphI ) KOD (PCR).(1 (10X) ShineGene Molecular Biotech, Inc., dntps MgSO 4 ) plus (China 1/5 0/ ºC ºC PCR (GenePro TM, China) ºC ºC ºC 5.. colony PCR 0/2

5 ..RT-PCR (1. mcgmp-kn cdna PCR -1 Table 1-The primers used for amplification of, colony PCR and RT-PCR. Length (bp) KpnI ( ) Sequence Primer name Restriction site (underlined) 43 SphI CCGGATCCCCATGGGCATGCATGTCTCTAAGTAAGGTG pcgmp-bns TCAGT 34 KpnI GGGCTAGCGGTACCGGTGTGATCGGATTGTAAGC mcgmp-kn 20 - ACTTTGCACACATGATCTGG mz1155 SphI. GFP (Invitrogen, USA). GeneMark (insert) 400 mm Tris-HCl, 100 mm ) MgCl 2, 100 mm DTT, 5 mm ATP [ph 7.8 at 25 C], 1% T4 DNA ligase, [Fermentas, (USA]. 30 pcgmp-) MP E. coli XLI.(Sambrook & Russell, 2001) colony PCR (mz1155). (BNS cdna (ZGFP) ( ) p35sgfphis3 TW-TN3 35S (Cauliflower mosaic virus; CaMV). HC- GFP P1 Pro HC-Pro NIa.(Hsu et al., 2004) PCR PCR Clean up kit, GeneMark, ) (Taiwan 147

6 1392 ABI 3730, Applied Biosystem, pzcgmp ). (CA.(1 ). (Fermentas, USA) EcoRI pzcgmp -1. (B) TW TN3 pzcgmp.(e) (D).(A) (C) Figure 1 -Genetic organization of pzcgmp vector; the name of ORFs and insertion site were shown. The cleavage recognition sites and the protein cleavage sites were shown as shadowy and with arrows (A). The symptoms of pzcgmp on squash leaf as vein banding (B) and on chenopodium as local lesion (D) compare to the symptoms of p TW TN3 as yellow mosaic on squash leaf (C) and on chenopodium (E).

7 (Lu & Moriyama, 2004) NTI Advance mm Tris HCl 5. [ph 7.2], 2% β-) mercaptoethanol, 10% sucrose, 0.005% (bromophenol blue, 10 mm EDTA 100. (SDS PAGE) (Tris base, glycine, Methanol) (Mini Trans-Blot Cell, Bio-Rad, CA) 110 (Amersham, USA) PVDF mm NaCl, 2.7 mm ) PBST KCl, 8m M Na 2 HPO 4, 1.46 mm KH 2 PO 4, (0.05% Tween (pzcgmp) Mini-prep plasmid purification kit, ) (GeneMark (Chenopodium quinoa). p TW-TN3.. pzcgmp (pcgmp-bns, mcgmp-kn).(1 ) RT-PCR Vector

8 1392 (England 5000 His-tag MP. Jackson ) goat anti-rabbit His-MAb goat anti-mouse (ImmunoResearch Laboratories, PA mm Tris HCl, ph 8.0, ) 15 mm MgCl 2, 10m M KCl, 20% [v/v] glycerol, 0.05% β-mercaptoethanol, 0.1 mm (phenylmethylsulphonyl fluoride (PMSF) Miracloth, ) A. 1% Triton X-100 1% DTT 0.25 mm (Calbiochem, CA 2ME 0.1% SDS Urea 8 M g.. nitro-blue tetrazolium/5-) bromo-4-chloro-3-30 indolyl phosphate paratoluidine salt in 100 mm NaCl, 5 mm. (MgCl 2, 100 mm Tris HCl, ph mm sodium carbonate, ) (ph 9.6, 0.01% sodium azide. ( ) ) 100 (Greiner Bio-One, Germany) 37ºC PBST (PBS. ºC ºC AP tablet ) 0.5 mg/ml, % diethanolamine, 0.02% (sodium azide, ph Bio-). (Tek instrument, USA His-MAb, Amersham Pharmacia Biotech, )

9 Alpha ) Density of AlphaInnotech IS2000. (Innotech Corporation, CA (pzcgmp) -1 ) p TW-TN3 C. quinoa.(d (vein banding).(c-1 B-1 ) RT-PCR (2 ) (2 ) RT-PCR mM Tris HCl [ph 8.0], 10mM ) (EDTA, 0.25% sodium sulfite g Triton X-100 (Calbiochem) g ). ( KCl.(Yeh & Gonsalves, 1984) /25 (Electro-Eluter 422, Bio-Rad, USA) ). ( His-MAb. (bovine serum BSA Spot SDS-PAGE SDS-PAGE albumin)

10 1392. His-tag His- p TW-TN3. 15 MAb. 31 pzcgmp CP.(3 ) p TW-TN3. 10 RT-PCR. 33.(3 ) His 20.(3 ) 4 30.(B) 10 RT-PCR (A) -2 Figure 2- Stability assay of in vector till 30 days post inoculation on squash using RT-PCR (A) and after 10 serial passages (B).

11 (B) (Mock) ZTN3 153 (A).(C) His-MAb ZGFP. Figure 3- Detection of recombinant protein at 5, 10, 15 and 20 days post inoculation using His-MAb (A) and detection of CP using its antiserum (B); plants inoculated with ZGFP were considered as positive control and plants inoculated with ZTN3 and buffer (Mock) were considered as negative control. (C), ELISA test corresponds to western blot treatments.

12 1392 M (B) SDS-PAGE (A) crude Purified (PageRuller TM Prestained, Fermentas, USA) m S P -4. BSA TW TN3 Figure 4- Western blot (A) and SDS-PAGE (B) analysis of purification procedure of the recombinant protein; M, Protein ladder (PageRuller TM Prestained, Fermentas, USA); crude, plant extraction after homogenizing with association buffer; S, supernatant; m, middle phase; Purified, purified protein from gel; TW TN3, negative control; BSA, bovine serum albumin /2 1/8.(4 ) 1980 Karg & ).(Kallio, 2009 (4 ). Bio-Rad, ) Electro-Eluter. (USA SDS-PAGE

13 Tobacco mosaic ) (virus, TMV Wheat stripe mosaic Choi ) N. benthamiana.(shivprasad et al., 1999) GUS ) (virus; WSMV WSMV-GFP (et al., 2000.(Tatineni et al., 2011) (Egelkrout et al., 2012).. HC-Pro P1 CGMMV. 10 (Masuta et al., 2000) HC-Pro P1.(Chen et al., 2007) Cucumber mosaic CGMMV CP.( ) virus-cp GFP. 155

14 1392 Chen ) P1 ) (CP MP NIb.(et al., 2007 Pro GFP GUS) (. 15 NIb P His-MAb MP-HC-Pro P1-MP. %100. NIa Seo & ).(Britt, 2008 HC- HC- Pro. RT-PCR 10 Gal-On ).(et al., Folimonov et ) (Citrus tristiza virus; CTV) (WSMV) GFP.(al., 2007; Tatineni et al., 2011 GUS 12 Choi et al., ) WSMV RT-PCR Turnip mosaic ) NIb/CP.(2000. (virus Brassica campestris C. quinoa

15 .. Rai & ).(Padh, E. coli.(giddings et al., 2000).(Mett et al., 2008).(Tatineni et al., 2011) SDS 1%+2ME 0.1%.. 40 SDS-PAGE. 2/2 1/8. 157

16 C. quinoa.. : Ainworth GC (1935). Mosaic disease of cucumber. Annals of Applied Biology 22: Alamillo JM, Monger W, Sola I, Garcia B, Perrin Y, Bestagno M, Burrone OR, Sabella P, Plana- Duran J, Enjuanes L, Lomonossoff GP, Garcia JA (2006). Use of virus vectors for the expression in plants of active full-length and single chain anti-coronavirus antibodies. Biotechnology journal 1: Antignus Y, Wang Y, Pearlsman M, Lachman O, Lavi N, Gal-On A (2001). Biological and molecular characterization of a new cucurbit-infecting Tobamovirus. Phytopathology 91: Carrington JC, Dougherty WG (1988). A viral cleavage site cassette: identification of amino acid sequences required for tobacco etch virus polyprotein processing. Proceedings of the National Academy of Sciences of the United States of America 85: Chen CC, Chen TC, Raja JAJ, Chang CA, Chen LW, Lin SS, Yeh SD (2007). Effectiveness and stability of heterologous proteins expressed in plants by Turnip mosaic virus vector at five different insertion sites. Virus Research 130:

17 Chen TC, Hsu HT, Jain RK, Huang CW, Lin CH, Liu FL, Yeh SD (2005). Purification and serological analyses of tospoviral nucleocapsid proteins expressed by Zucchini yellow mosaic virus vector in squash. Journal of Virological Methods 129: Choi IR, Stenger DC, Morris TJ, French R (2000). A plant virus vector for systemic expression of foreign genes in cereals. Plant Journal 23: Desbiez C, Gal-On A, Raccah B, Lecoq H (1997). Characterization of epitopes on Zucchini yellow mosaic potyvirus coat protein permits studies on the interactions between strains. Journal of General Virology 78: Egelkrout E, Rajan V, Howard JA (2012). Overproduction of recombinant proteins in plants. Plant Science 184: Folimonov AS, Folimonov SY, Bar-Joseph M, Dawson WO (2007). A stable RNA virus-based vector for citrus trees. Virology : 368. Francki RI, Hu J, Palukaitis P (1986). Taxonomy of cucurbit-infecting tobamoviruses as determined by serological and molecular hybridization analyses. Intervirology 26: Gal-On A, Meiri E, Raccah B, Gaba V (1998). Recombination of engineered defective RNA species produces infective potyvirus in planta. Journal of Virology 72: Giddings G, Allison G, Brooks D, Carter A (2000). Transgenic plants as factories for biopharmaceuticals. National Biotechnology 18: Gleba Y, Marillonnet S, Klimyuk V (2004). Engineering viral expression vectors for plants: the 'full virus' and the 'deconstructed virus' strategies. Current Opinion in Plant Biology 7: Gleba Y, Klimyuk V, Marillonnet S (2007). Viral vectors for the expression of proteins in plants. Current Opinion in Biotechnology 18: Gleba Y, Marillonnet S, Klimyuk V, Mahy BWJ, Van Regenmortel MHV (2008). Plant Virus Vectors (Gene Expression Systems). Oxford Academic Press, UK. Gopinath K, Wellink J, Porta C, Taylor KM, Lomonossoff GP, Van Kammen A (2000). Engineering Cowpea Mosaic Virus RNA-2 into a Vector to Express Heterologous Proteins in Plants. Virology 267: Hsu CH, Lin SS, Liu FL, Su WC, Yeh SD (2004). Oral administration of a mite allergen expressed by zucchini yellow mosaic virus in cucurbit species downregulates allergen-induced airway inflammation and IgE synthesis. Journal of Allergy and Clinical Immunology 113: Karg SR, Kallio PT (2009). The production of biopharmaceuticals in plant systems. Biotechnology Advances 27: King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ (2012). Virus Taxonomi: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press, USA. Komuro B (1965). [on Diffusion of Lincomycin into Eye Tissues, with Special Reference to a Sensitivity Test for Pathogenic Staphylococci]. J Antibiot B 18: Lee KW, Lee BC, Park HC, Lee YS (1990). Occurrence of cucumber green mottlemosaic virus disease of watermelon in Korea. Korean Journal of Plant Pathology 6: Lin SS, Hou RF, Yeh SD (2002). Construction of in vitro and in vivo infectious transcripts of a Taiwan strain of Zucchini yellow mosaic virus. Botanical Bulletin of Academia Sinica 43: Lu G, Moriyama EN (2004). Vector NTI, a balanced all-in-one sequence analysis suite. Brief Bioinform 5:

18 1392 Masuta C, Yamana T, Tacahashi Y, Uyeda I, Sato M, Ueda S, Matsumura T (2000). Development of clover yellow vein virus as an efficient, stable gene-expression system for legume species. Plant Journal 23: Mett V, Farrance CE, Green BJ, Yusibov V (2008). Plants as biofactories. Biologicals 36: Oh CS, Carrington JC (1989). Identification of essential residues in potyvirus proteinase HC-Pro by site-directed mutagenesis. Virology 173: Rai M, Padh H (2001). Expression systems for production of heterologous proteins Current Science 80: Rahimian H, Izadpanah K (1977). A new strain of Cucumber green mottle mosaic virus from Iran. Iranian Journal of Agricultural Research 5(1): Revers F, Van Der Vlugt RA, Souche S, Lanneau M, Lot H, Candresse T, Le Gall O (1999). Nucleotide sequence of the 3' terminal region of the genome of four lettuce mosaic virus isolates from Greece and Yemen. Archives of Virology 144: Riechmann JL, Lain S, Garcia JA (1992). Highlights and prospects of potyvirus molecular biology. Journal of General Virology 73 ( Pt 1): Riechmann JL, Lain S, Garcia JA (1992). Highlights and prospects of potyvirus molecular biology. J Gen Virol 73: Saito T, Imai Y, Meshi T, Okada Y (1988). Interviral homologies of the 30K proteins of tobamoviruses. Virology 167: Sambrook J, Russell MDW (2001). Molecular Cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, USA Seo JY, Britt WJ (2008). Multimerization of tegument protein p28 within the assembly compartment is required for cytoplasmic envelopment of human cytomegalovirus. Journal of Virology 82: Shang H, Xie Y, Zhou X, Qian Y, Wu J (2011). Monoclonal antibody-based serological methods for detection of Cucumber green mottle mosaic virus. Virology Journal 8: 228 Shivprasad S, Pogue GP, Lewandowski DJ, Hidalgo J, Donson J, Grill LK, Dawson WO (1999). Heterologous Sequences Greatly Affect Foreign Gene Expression in Tobacco Mosaic Virus- Based Vectors. Virology 255: Tan SH, Nishiguchi M, Murata M, Motoyoshi F (2000). The genome structure of kyuri green mottle mosaic tobamovirus and its comparison with that of cucumber green mottle mosaic tobamovirus. Archives of Virology 145: Tatineni S, Mcmechan AJ, Hein GL, French R (2011). Efficient and stable expression of GFP through Wheat streak mosaic virus-based vectors in cereal hosts using a range of cleavage sites: Formation of dense fluorescent aggregates for sensitive virus tracking. Virology 410: Ugaki M, Tomiyama M, Kakutani T, Hidaka S, Kiguchi T, Nagata R, Sato Motoyoshi TF, Nishiguchi M (1991). The complete nucleotide sequence of cucumber green mottle mosaic virus (SH strain) genomic RNA. Journal of General Virology 72: Verchot J, Koonin EV, Carrington JC (1991). The 35-kDa protein from the N-terminus of the potyviral polyprotein functions as a third virus-encoded proteinase. Virology 185: Yeh SD, Gonsalves D (1984). Purification and immunological analysis of cylindrical-inclusion protein induced by papaya ringspot virus and watermelon mosaic virus 1. Phytopathology 74:

19 Expression and purification of movement protein of Cucumber green mottle mosaic virus using a plant-virus expression system Nassaj Hosseini S.M. 1, Shams-Bakhsh M. 2, Salamanian A.H. 3, Yeh S.D. 4 1 Ph.D. Student of Tarbiat Modares University, Tehran, Iran. 2 Associate Professor of Tarbiat Modares University, Tehran, Iran. 3 Associate Professor of National Institute of Genetic Engineering and Biotechnology, Tehran, Iran. 4 Professor of National Cheng Hsing University, Taichnug, Taiwan. Abstract To produce and purify movement protein of Cucumber green mottle mosaic virus (), a plant viral vector engineered from an in vivo infectious clone of Zucchini yellow mosaic virus () was used. The ORF was in frame inserted between the P1 and HC-Pro ORFs of the vector. The infectious activity of the vector was approved by rubbing the plasmid on Chenopodium quinoa leaves and observing local lesions. Individual lesions were mechanically transferred to the systemic host plant zucchini squash at the stage of two-cotyledon. The stability of recombinant protein expression was assessed by successive passages of recombinant from infected plant and throughout the period of 30 days after inoculation in a single plant and after 10 serial passages. Then, the leaves tissues of inoculated plant were analyzed by RT-PCR and western blot analysis. Recombinant protein was purified using centrifuge method combine with gel extraction; each step was sampled and analyzed by western blotting and SDS-PAGE. The results showed approximately mg recombinant MP per 100 g tissues were purified from leaves two weeks post inoculation. Also, the vector was remarkably stable in squash after 10 serial passages and 30 days. The procedure provides a convenient and fast method for production of large quantities of pure in planta. Keywords: transient expression, recombinant protein,. Corresponding author: Shams-Bakhsh M. Tel:

جستجوی ویروس بلوتانگ در شتر‌های یک کوهانه‎ی کشتار شده در نجف‌آباد (مرکز ایران) با روش RT-PCR

جستجوی ویروس بلوتانگ در شتر‌های یک کوهانه‎ی کشتار شده در نجف‌آباد (مرکز ایران) با روش RT-PCR ن ش ر ی ه م ی ک ر ب ی و ل و ژ ی د ا م پ ز ش ک ی / د و ر ه چ ه ا ر د ه م ش م ا ر ه ا و ل 1 7 9 3 پ ی ا پ ی 9-8 : 6 3 8 1 ک ل و ن ی ن گ و ب ی ا ن ژ ن NP و ی ر و س آ ن ف ل و ا ن ز ا ی پ ر ن د گ ا ن ت ح ت

توضیحات بیشتر

دانشگاه علوم پزشكي اردبيل

دانشگاه علوم پزشكي اردبيل دانشگاه علوم پزشكي و خدمات بهداشتی درمانی اردبيل دانشکده پزشکی پايان نامه جهت دريافت درجه دكتراي حرفه اي در رشته ی پزشکی : بررسي آنتی بادی ضد هسته اي )) در كودكان مبتال به ليشمانيوز احشايی در اردبيل در

توضیحات بیشتر

Microsoft PowerPoint - Versatile molecular approaches for HBsAg positive patients, who are PCR negative - Dr. Ghaziasadi.pptx

Microsoft PowerPoint - Versatile molecular approaches for HBsAg positive patients, who are PCR negative - Dr. Ghaziasadi.pptx Versatile molecular approaches for HBsAg positive patients, who are PCR negative. Is it possible to be HBsAg positive but HBV PCR negative?? Azam Ghaziasadi Hepatitis B &D Lab Department of Virology Tehran

توضیحات بیشتر

Microsoft PowerPoint - PCR final [Compatibility Mode]

Microsoft PowerPoint - PCR final [Compatibility Mode] In the Name of God Polymerase Chain Reaction Dr. F Bokharaei Salim Virology Department, Iran University of Medical Sciences مقدمه: واكنش زنجيره اي پليمراز (PCR) آزمايشي است كه با آن در شرايط آزمايشگاهي

توضیحات بیشتر

Microsoft PowerPoint - Plant Organogenesis_2 embryo

Microsoft PowerPoint - Plant Organogenesis_2 embryo Embryogenesis جنين زايی ١ ٢ Double fertilization .١.٢.٣.۴.۵.۶ ايها دولپه حالتهای مختلف جنين زايی در تيپ شب بو تيپ کاسنی تيپ سيب زمينی تيپ ميخک تيپ اسفناج تيپ فلفل سياه (Onagrad) (Astrerad) (Solanad) (Caryophyllad)

توضیحات بیشتر

شماره: 87/469057 تاریخ: 88/12/15 باسمهتعالی بخشنامه به واحدهاي دانشگاه آزاد اسلامی موضوع: مجلات خارجی کماعتبار و ناشناخته با توجه به اینکه تعدادي از موسسات غیر معتبر داخلی و خارجی با دریافت مبالغی از نویسندگان

توضیحات بیشتر

چکیده

چکیده شکل رفتار بررسي غيرخطي ستونهای مزدوج مرکب در سازه های رايج فوالدی * PB H PB H PE PE [ ] شکل : 1 نمای سه بعدی ستونهای مرکب مزدوج شکل به- همراه اتصاالت گيردار. PE PE Email: mghassem@ut.ac.ir * 3m PE PE PE

توضیحات بیشتر

PowerPoint Presentation

PowerPoint Presentation 1 به نام خداوند بخشنده و مهربان جایگاه EN 1090 در کمیته متناظر سازه هاي فولادي ISO/INSO TC 167 اروپا مهندس رضا ایمانیان نجف آبادي دبیر کمیته متناظر سازه هاي فولادي در سازمان ملی استاندارد ایران ISO/INSO

توضیحات بیشتر

راهنمای تهیه مقاله.xps

راهنمای تهیه مقاله.xps م ق ر ز ر ه د ی ر ب ه خ ا ش ی ا ه ل گ ر م ع م ا و د و ی ک ی ژ و ل و ی ز ی ف ی ک ی ژ و ل و ف ر و م صفات برخی ه س ی ا ق م ن ی د ی م ر پ س ا و ن ی م ر پ س ا ن ی س ی ر ت و پ د ر ب ر ا ک ا ب grand prix ر و

توضیحات بیشتر

F1156 Farsi IranArze

F1156 Farsi IranArze ارائه شده توسط: سايت ه فا مرجع جديد مقا ت ه شده از ن ت معت : :. $& # "! ( 45 3 12+ 0. +,! @? =5>. < : ; : 89 7#. 3 6. 20 #!. GH I $ DE $! " 5C B2 A5>. $& # 7 # 1O@+ 4 + &LM J! MR $ QP 85P #?,:. S+. $&

توضیحات بیشتر

لیست قیمت محصولات ciscoIP (چاپ)

لیست قیمت محصولات ciscoIP (چاپ) خرید سوي یچ شبکه 1,200,000,000 سوي یچ شبکه سیسکو 48 پورت S-C3850-48XS-WS سوي یچ شبکه 48 پورت سیسکو 2 روز S-48TS 3750 قبل 14,000,000 سوي یچ 24 پورت سیسکو 2 روز S1U-24TS 3750G قبل 30,000,000 32,000,000 سوي

توضیحات بیشتر

Microsoft Word - Document1

Microsoft Word - Document1 دا ه ع وم زپش ی مان دانشكده پزشكي پايان نامه مقطع كارشناسي ارشد قارچ شناسي پزشكي عنوان: بررسي اثرات ضد قارچي دو گونه پروبيوتيك بر جدايه ه يا كانديدا جدا شده از افراد HIV/AIDS و افراد سالم در شهر كرمان

توضیحات بیشتر

جستجوی ویروس بلوتانگ در شتر‌های یک کوهانه‎ی کشتار شده در نجف‌آباد (مرکز ایران) با روش RT-PCR

جستجوی ویروس بلوتانگ در شتر‌های یک کوهانه‎ی کشتار شده در نجف‌آباد (مرکز ایران) با روش RT-PCR ن ی ی ش 1 2 7-2 : 2 3 ی پ ا ی پ 5 9 3 1 ل و ا ه ا م ش م ه د ز ا و د ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب ک ی م ه ی ش ن پ ی ت و س ی ل و ک ل و م ص ی خ ش ت B/793 ی ن و ف ع ت ی ش ن و ب س و ی و ز ا ی ش ف ا

توضیحات بیشتر

شناسایی و تشخیص ویروس موزاییک معمولی لوبیا و موزاییک نکروتیک معمولی لوبیا با استفاده از روش Immunocapture RT-PCR

شناسایی و تشخیص ویروس موزاییک معمولی لوبیا و موزاییک نکروتیک معمولی لوبیا با استفاده از روش Immunocapture RT-PCR مجله تازه هاي بیوتکنولوژی سلولي مولكولي دوره سوم شماره یازدهم تابستان 1392 شناسایی و تشخیص ویروس موزاییک معمولی لوبیا و موزاییک نکروتیک معمولی لوبیا با استفاده از روش Immunocapture RTPCR 5 نگیسا ساالری

توضیحات بیشتر

3.xps

3.xps ز ا ه د ا ف ت س ا ا ب ل س گ ثر ا ت ز ا ذر پ سب آ ق ط ا ن م ر د ر ه ش ا ه ه ا گ ت ن و ک س ه ع س و ت ارزاب رز( ب ت ه ش م غ ا ب ک ر ه ش : د ر و م ه ع ل ا ط م ( ه ر ا ع م د ن چ ا ه ش و ر س پ د ال ب ل ع د ن

توضیحات بیشتر

بررسی تغییر ژن پروتئین M2 ویروس آنفلوانزا H1N1 در بیان آن درباکتری Ecoli سویه BL21

بررسی تغییر ژن پروتئین M2 ویروس آنفلوانزا H1N1 در بیان آن درباکتری Ecoli سویه BL21 Research on Medicine The Quarterly journal of School of Medicine, Shahid Beheshti University of Medical Sciences Original Article Vol.39; No.2; 2015 Evaluation of Modification in M2 gene of Influenza H1N1

توضیحات بیشتر

اساس کار آزمایش واکنش زنجیره ای پلیمراز PCR: Polymerase Chain Reaction آزمایش واکنش زنجیره ای پلی مراز Reaction( )Polymerase Chain یا به اختصار PCR در

اساس کار آزمایش واکنش زنجیره ای پلیمراز PCR: Polymerase Chain Reaction آزمایش واکنش زنجیره ای پلی مراز Reaction( )Polymerase Chain یا به اختصار PCR در اساس کار آزمایش واکنش زنجیره ای پلیمراز PCR: Polymerase Chain Reaction آزمایش واکنش زنجیره ای پلی مراز Reaction( )Polymerase Chain یا به اختصار PCR در حقیقت یک دستگاه تکثیر DNA و یا RNA می باشد که همانند

توضیحات بیشتر

F841 Farsi IranArze

F841 Farsi IranArze ارائه شده توسط: سايت ه فا مرجع جديد مقا ت ه شده از ن ت معت :! "#$ % & '( ) * +&!,. +3! +# 45 +.)& + )781 &! ) $ / 01 2 $ )9 :3, ; & & + (?.& ; @ (# 9 )! + /# A 4 #8.B 01,CD? E# B@F! G + +;

توضیحات بیشتر

Microsoft Word - 2-jafari.doc

Microsoft Word - 2-jafari.doc ژنتيك نوين دوره دهم شماره 2 تابستان 1394 صفحه 151-166 بيان آنتيبادي تك دودماني ضد HER2/neu انساني Trastuzumab در توتون تراريخته Expression of the humanized anti-her2/neu monoclonal antibody trastuzumab

توضیحات بیشتر